Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AG0449
Clone ID AG0449
Vector pGT0lxr
Project sanger

Sequence tag AG0449
Sequence
TAGCAGATGACCAAGATCACATTTTATTCCACTCTGGGGACGGAAGTGACAAACTNNGNNNGNGNNNNNNTTTGCCCCCG
GGGGGGTGAAGTGGACTTTTTTTTTTTTTTTTCGGCTTCTGGCAGCCGGTCGGGCTTCGGGAGCCCATCATGGTCTTCCT
CACGACGCGGCTCTGGCTGCGGAACCGCCTCACCGATCGCTATTGGCGGGTTCAGGAGGTGCTGAAACACGCTCAGCATT
TTCGGGGAAGGAAGAATCGCTGCTACCGCCTGGCCGTCAGGGCGGTGACCAGAGCCTTCGTTAAGTGTACGAAGGCCCGC
CGACTTAAGAAGCGGAACCTGAGGACCCTCTGGATTAATCGAATTACAGCTGCCTCCCAGGAACATGGCTTAAAGTACCC
AGCATTCATTGTCAACTTAATTAAG
Sequence Type mRNA
Unitrap ID UNI2287

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 155177730..155181094 122
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029066 (Mrpl20) NM_025570 mitochondrial ribosomal protein L20 Gene [Source:MGI (curated);Acc:Mrpl20-001]

 
Come back to gene ENSMUSG00000029066


For any suggestions or comments, please send an email to unitrap@crg.es