Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14595F7
Clone ID IST14595F7
Vector VICTR74
Project tigm

Sequence tag IST14595F7HMR1
Sequence
TCCNATTCCTGGCTTGTGAGAGGGAACCAAGTAACCNTAGAGGGAAGGGTCTTTGAACGGTGTGACTTTGGAGGGTTAGT
GGACATCCTGANAAACTTCTACTGAGGAATTTTCCCACTGCAGGGTTACTCTCCTTTGACCATTTCTAATGTGGGGGCTC
GGCCTTCCCAACTCATTANAGCTCTGTCCTTTGGCTTATTTTAGTTTTTGACACATCGTCTTATGTANCCCAGGCTAGCT
TCAAACGCGAACAGCTGATCCACTTGCCTTCAAGTGCTTCTTATTTCAAGTACTATTCACTGTGCTCTGCTTCCCTGANT
TTGTCC
Sequence Type genomic DNA
Unitrap ID UNI23167

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 117852401..117852725 313
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017715 (Pgs1) NM_133757 phosphatidylglycerophosphate synthase 1 Gene [Source:MGI (curated);Acc:Pgs1-001]


Sequence tag IST14595F7HMF3
Sequence
NANGTATATGAGAGAGTACGTGTGTACNGGTGCCTGTGGGTGTGTACAGTGCCTGTGGANAACANAANANGGCNTCNNAT
CCCCTGCNTCTANAGTTACNNGTGATTGNGGACGCCTAACATANGTGTTGGGAACNAANCTTATATCCNNNNNAANANCA
NANNNNNCATTATTGACTTCNGAGCCNTCTTTCTNNTCCCCTTANCAGACTATATAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000017715


For any suggestions or comments, please send an email to unitrap@crg.es