Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10669G11
Clone ID IST10669G11
Vector VICTR76
Project tigm

Sequence tag IST10669G11BBF1
Sequence
CAGATGTGTCCTTGCTGTGGCAGGAGGGCAGGATCT
Sequence Type genomic DNA
Unitrap ID UNI23434

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 36664119..36664153 35
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032118 (Fez1) NM_183171 fasciculation and elongation protein zeta 1 (zygin I) Gene [Source:MGI Symbol;Acc:MGI:2670976]

 
Come back to gene ENSMUSG00000032118


For any suggestions or comments, please send an email to unitrap@crg.es