Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AG0321
Clone ID AG0321
Vector pGT0lxr
Project sanger

Sequence tag AG0321
Sequence
CGGAAGGTGGTGGTCGTACGCTGTGAAGGCATCAACATTTCTGGAAACTTCTATATAAACAAGTTAAAGTATCTGGCCTT
TCTCCGGAAGNCGGATGAATACCAACCCCTCCCGAGGCCCCTACCACTTCCGAGCCCCCAGCCGCATTTTCTGGCGCACT
GTGCGAGGCATGCTGCCCCTTTAGCCCAAGGTAGGCCAGGCTGCCCTGTGAGCTCCTCAAGGTGTTGGAACGCATCTCTC
CCACGTATCACTAGATTATTCGCCTGGTGGTCCTTTCGGCTCTCCAGCATGTTAGGTCGAAGCTTTCTATTTATGTTTGC
TCATCTCGCCCGTCTGGCACATGAGGTCGGGTGGAAGTACCAGGCAGTGACAGCCACTCTGGAGGAGAAACGGAAGGAAA
AGGCCAAGATGCACTATCGGAAGAAGAAGCAGATCTTG
Sequence Type mRNA
Unitrap ID UNI2290

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 52381485..52382642 112
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000003426 (Rpl13a) NM_009438 ribosomal protein L13a Gene [Source:MGI (curated);Acc:Rpl13a-001]

 
Come back to gene ENSMUSG00000003426


For any suggestions or comments, please send an email to unitrap@crg.es