Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14641H2
Clone ID IST14641H2
Vector VICTR74
Project tigm

Sequence tag IST14641H2HMF1
Sequence
GAACCAGCAGATCAGACACAAATAGCTCTGCATTCTTGCTCCTCCTGTACTGTCAATGGACATTACTATAATAACCAGGG
GATGGCTTGTGGTCTTCCTGGCAGCTTGTAACACATGCATCTGAGGAGAATCCTGTAAAGAACCTGCATGCTACCTTCCC
CTAGTGTTCCTGATTGTTAGGCCTGCCCAGAGTCCNNCNNTAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 175460814..175461008 195
NO GENE  


Sequence tag IST14641H2HMR1
Sequence
CTAAATGGACTGTANATCAAAGTTTGGTTCTGTTGTTCCTTGTGGTGATCATAGCAGATGCCCTTGTCCTTTGACTCTTC
CTGAGTGTGGATTTACAGGGGTGCTGGTC
Sequence Type genomic DNA
Unitrap ID UNI3415

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 177501355..177501462 104
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078864 (OTTMUSG00000016321) predicted gene, OTTMUSG00000016321 Gene [Source:MGI Symbol;Acc:MGI:3652185]

 
Come back to gene ENSMUSG00000078864


For any suggestions or comments, please send an email to unitrap@crg.es