Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12400B5
Clone ID IST12400B5
Vector VICTR76
Project tigm

Sequence tag IST12400B5BBF1
Sequence
AGCACAGGTTTGTGAGATGAGTTCCTCCTCCTTGCCGGTTCAGAGAGGTCCAAGGGTGCCTAGGAGAGATTGGAGGAGCT
CCAGCCGCTAGTGCAAGTTTCTGTACTGCCGTGCGTGAGCCCGGCTGCAGGGCGCACCTGTCAGTGGGAGAGTTGCTGTT
AATCTTGCAGCCCTCAAAGTTCTACTGCTGGGTAGGGAGGTGTGCGTCCTTGCCTGGAGGTTTTTATTTCTTTTCATTGT
CCTATGGGACATGGATCT
Sequence Type genomic DNA
Unitrap ID UNI14765

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 109395158..109395414 257
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031910 (Has3) NM_008217 hyaluronan synthase 3 Gene [Source:MGI Symbol;Acc:MGI:109599]


Sequence tag IST12400B5HMF1
Sequence
AGCACAGGTTTGTGAGATGAGTTCCTCCTCCTTGCCGGTTCANAGAGGTCCAAGGGTGCCTAGGAGAGATTGGAGGAGCT
CCAN
Sequence Type genomic DNA
Unitrap ID UNI14765

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 109395158..109395240 81
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031910 (Has3) NM_008217 hyaluronan synthase 3 Gene [Source:MGI Symbol;Acc:MGI:109599]

 
Come back to gene ENSMUSG00000031910


For any suggestions or comments, please send an email to unitrap@crg.es