Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14703A4
Clone ID IST14703A4
Vector VICTR76
Project tigm

Sequence tag IST14703A4HMR1
Sequence
AATNNGCGTTGGCTTTAGGGGAATTAATTGATGAAGGTGTCTCCGGACGAGCTCACTTCACTCTGTCATTTTATTTGTAG
CTAAAGCAGCGGCGGGAATAGCAGCTGCATTTCTTTTCTCTTTCTCCCTTCACATTCCATTATCATAGTGCTCCAATGGA
GAAGGAAGGAGTAGCGGGGCCCAGGTACTGATCCGCATCGAGGACTCANACCAACACACTGGCANAGCTGAAACCGGATG
GTCTTTTCCCTCTTTTTTAAAAAAACGAAAACCAAAAAAAAAAAAAAAAAAAN
Sequence Type genomic DNA
Unitrap ID UNI32079

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 17970206..17970497 284
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000054074 (2810030E01Rik) RIKEN cDNA 2810030E01 gene Gene [Source:MGI Symbol;Acc:MGI:1919918]


Sequence tag IST14703A4HMF1
Sequence
ATTGGACACTCCTGACAGGTGATGCAATAAAAATTGATATTCCACCCCTTCCCCCCAAAATCTCCTACTAATTAGCATAC
CCTTATACTGCCACCTCCCCTCCCAAAGTAAATAATACAGCCGGTATATAAATCTTTCCATTAAACTATCGGAGCTCAGA
AACAGCCTGACTCACAGACTTCATCAGAAGCAGTGTATGTACGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA
GAGAGAGAGAGAGAGAGANAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 17970495..17970752 258
 
EST/CDNA Est Name
  CJ179121.1

 
Come back to gene CJ179121.1


For any suggestions or comments, please send an email to unitrap@crg.es