Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10465H2
Clone ID IST10465H2
Vector VICTR76
Project tigm

Sequence tag IST10465H2BBF1
Sequence
CTCTGTGTAGCTCTGGCTGTCCTGGAACTCACTC
Sequence Type genomic DNA
Unitrap ID UNI17455 UNI34178 UNI34179 UNI34180

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_165754: 351238..351271 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 4010433..4010466 34
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037916 (Ndufv1) NM_133666 NADH dehydrogenase (ubiquinone) flavoprotein 1 Gene [Source:MGI Symbol;Acc:MGI:107851]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 3486798..3486831 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 4143874..4143907 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 4354587..4354620 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 8764684..8764717 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 5858024..5858057 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 3141981..3142014 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 3498733..3498766 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 4822407..4822440 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 20801541..20801574 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 6180713..6180746 34
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040675 (Mthfd1l) NM_172308 methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1-like Gene [Source:MGI (curated);Acc:Mthfd1l-003]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 4232211..4232244 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 3927728..3927761 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 3376413..3376446 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 3921478..3921511 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 7650123..7650156 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 7387262..7387295 34
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027499 (Pkia) NM_008862 protein kinase inhibitor, alpha Gene [Source:MGI Symbol;Acc:MGI:104747]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7465435..7465468 34
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031156 (Slc35a2) NP_511039 solute carrier family 35 (UDP-galactose transporter), member A2 Gene [Source:MGI (curated);Acc:Slc35a2-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 5204351..5204384 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 4796559..4796592 34
NO GENE  

 
Come back to gene ENSMUSG00000031156


For any suggestions or comments, please send an email to unitrap@crg.es