Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13318G10
Clone ID IST13318G10
Vector VICTR74
Project tigm

Sequence tag IST13318G10BBF1
Sequence
ACACAATTATTCTGTCCTAGGATAGTGGGTCTCCCACCCTCCCTTCGCACTTGGGAACCGACCGTTTCATTCCCCTTTCT
CCAACCTTAGGCTTTGGTCAAACTCTTTCTTCCCGTATCTTAAAGGTCCCTCACGCCGCGGTCTGGTCCTCTATCCCAAA
ACGGAGTAATTGGATCTTGGTCCAGTTCTCATCTCTATCCTGTTCCGGTAGCCGCCTGCACCCTTTTGGATCTCCGACCA
GTCCTCTGCCCAGTCGCGGGGTGAGGCTCGTGGANCTTGAANCTTCAGTGGGCCGGANGTGCNATTCNCCNGCCAGTTCG
GGTCCNTGCGGCGCGCCCCCGGCAGCCGTGCCAGTCGCACTGCGGGCGCTGCGTCCCGCTGCNTGCCTGGNGCTGN
Sequence Type genomic DNA
Unitrap ID UNI34181

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 34629974..34630367 367
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037224 (Zfyve28) NM_001015039 zinc finger, FYVE domain containing 28 Gene [Source:MGI (curated);Acc:Zfyve28-001]

 
Come back to gene ENSMUSG00000037224


For any suggestions or comments, please send an email to unitrap@crg.es