Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14734B2
Clone ID IST14734B2
Vector VICTR76
Project tigm

Sequence tag IST14734B2BBF1
Sequence
GTCAAGCTGTCAATGCCAAAGACTCTTCAGTAGCAGAAAGCTGAACAACGTTAGCAGGGAGAGATAAAGATGAAGCTCAG
GGCAGATACTGGCCTGGGACACGTGAAGTCCTGGGTTCAATCCCAAGCAGCAAAAGTTAAAAAATAAAAAACAAGAGAAA
GGACTAGTAGCATAATCAGTAATATCATACCAAATTAGTGGATTATTATCTAGGAATTAAAATGGTAGAGAAGGGCTGGA
GAGGTGGCTCCTTGATTGANAGCACTAACTGCNCTTCTGGANGAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 101949699..101949982 276
 
EST/CDNA Est Name
  BY007731.1 - BY022021.1 - BY228698.1 - BY232852.1 - BY789605.1 - BY787212.1 - BY787244.1 - BY129488.1 - CF904850.1 - BY144268.1 - BY137848.1 - BY781742.1


Sequence tag IST14734B2HMR1
Sequence
TGACAGTGGGGATGGCACCCCCACCACCCATTTCCCAGGACTGGGTTCTCAGAAACAAGACTGTGCTGTANGGCGGGAGC
TCTTCCTGCCCGTGTCCACAGACTGCCCACTTGTTTTGCTATAGGCCTGCACTGGTTTGCTTTCACTGGCCN
Sequence Type genomic DNA
Unitrap ID UNI16355

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 101949552..101949702 149
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048058 (Ldlrad3) NM_178886 low density lipoprotein receptor class A domain containing 3 Gene [Source:MGI (curated);Acc:Ldlrad3-001]


Sequence tag IST14734B2HMF1
Sequence
GTCAAGCTGTCAATGCCAAAGACTCTTCAGTAGCAGAAAGCTGAACAACGTTAGCAGGGAGAGATAAAGATGAAGCTCAG
GGCAGATACTGGCCTGGGACACGTGAAGTCCTGGGTTCAATCCCAAGCAGCAAAAGTTAAAAAATAAAAAACAAGAGAAA
GGACTAGTAGCATAATCAGTAATATCATACCAAATTAGTGGATTATTATCTAGGAATTAAAATGGTAGAGAAGGGCTGGA
GAGGTGGCTCCTTGATTGAGAGCACTAGCTGCTCTTCTGGAGGACCAGGGTTCAGTTCCCAGCACCCACATGTCCATACC
TCCAGTTCCAGGGGAGCCAGTATCCTCATACAGACATGCAGGCAGGCAAAACACCAATGCACATAAACTAAGATATTACA
TGATAGTGAATTATAGAAAAATCNCTAAGANGACATCACGGGGAAATCGCANNGGAAAAACTGGGAATGAAAAACTGGAC
TTTCCATGGTGANTGCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 101949699..101950194 486
 
EST/CDNA Est Name
  CK633898.1 - CN527209.1 - BB615291.1 - BB664369.1 - BB622520.1 - AI591432.1 - BB648353.1 - BB857854.1 - BY007731.1 - BY022021.1 - BY228698.1 - BY232852.1 - BY789605.1 - BY152880.1 - BY787212.1 - BY787244.1 - BY129488.1 - CF904850.1 - BY144268.1 - BY137848

 
Come back to gene CK633898.1 - CN527209.1 - BB615291.1 - BB664369.1 - BB622520.1 - AI591432.1 - BB648353.1 - BB857854.1 - BY007731.1 - BY022021.1 - BY228698.1 - BY232852.1 - BY789605.1 - BY152880.1 - BY787212.1 - BY787244.1 - BY129488.1 - CF904850.1 - BY144268.1 - BY137848


For any suggestions or comments, please send an email to unitrap@crg.es