Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12235G5
Clone ID IST12235G5
Vector VICTR76
Project tigm

Sequence tag IST12235G5BBF1
Sequence
ATCCCAAGNGACAGAAATTAGGGGGAGGAAATAGATATCCTGCTGTCTCTGGGGATTTTTTTTTTTTTTTTTTTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 155336928..155337002 73
NO GENE  


Sequence tag IST12235G5HMF2
Sequence
ATTCATTTGGGTACCAGCCAGTAACTGAAAAAATTTTTTAAAAGACCCTAAATTTATTATTTCAAAAGGACATTCTAGAT
CCCTCCATAAATGGAAAGCCAGAATTTGTGACATAAATAGAAAGTAATTTAAAAAATAAGCATAAAAATAAGCATAATAG
CCGGGTGTGGTGGCACACGCACCACCCAGCACTCGGGAGGCAGAGGCAGACGGATTTCTGAGCTCAAGGCCAGCCTGGTC
TACAAAGTGAGTTCCGGGATAGCCAGGGCTACACAGAGAAACCCTGTCTCGAACCCCCCACCCCCCAAAAAAAGCATAAT
GAAAACAATGTCACAAAACTCCATCCAGNGCTGGTGGA
Sequence Type genomic DNA
Unitrap ID UNI11490

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 154161880..154162236 355
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027487 (Cdk5rap1) NM_025876 CDK5 regulatory subunit associated protein 1 Gene [Source:MGI (curated);Acc:Cdk5rap1-001]

 
Come back to gene ENSMUSG00000027487


For any suggestions or comments, please send an email to unitrap@crg.es