Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11661G7
Clone ID IST11661G7
Vector VICTR76
Project tigm

Sequence tag IST11661G7BBF1
Sequence
GAACAGGGAGGTAAGCTGCCTTCTANAGGAACTAAACCAAAAATCATTATAGGAAATAACCAAATTTGTGCTTTGAACAA
ACATTTAAAGAACTTCCAAAGAACCCGTTAGGTGTTANATAATTTCCTTTATTATAGTATTTCCAATATAAACTCTTTTT
ATTCCGAAAGTTTTAAACCTTCAAATCTTAAGAGGCTTGANTGCGGAAATAGTAATTGAATAAACATTATTGTTGCTTTG
ANAAACATCTTTCACTGAATCTGAGCTCGAGTGTGTGTCTTCCTCTGAATAGTTGTTTCTTGANATACTTGATGCCTTGC
AAAGCTCGCAGCCTGCTGCCGTCTCCCTCGGCGTGATGAAACTAGCTTCCTGTCTGGAGCGAGCCCTCGGCGACGTGAGT
GTGANAATCCTCATGGATGANCACAGAACTTCAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI22169

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 15118248..15118685 424
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079709 (AC182749.2-203) NP_001116842 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:Q8C5D3]

 
Come back to gene ENSMUSG00000079709


For any suggestions or comments, please send an email to unitrap@crg.es