Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12695G12
Clone ID IST12695G12
Vector VICTR76
Project tigm

Sequence tag IST12695G12BBF1
Sequence
ACAGTTCCACAGGCCGCATCACCATGCCTAGCTGTATTTTACTTAGCATTTCTTTCCTTCACACTTTAAATTTTATTTTG
GGGAGTTTGN
Sequence Type genomic DNA
Unitrap ID UNI1985

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 22406912..22407000 89
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000013089 (Etv5) NM_023794 ets variant gene 5 Gene [Source:MGI Symbol;Acc:MGI:1096867]


Sequence tag IST12695G12HMF1
Sequence
ACAGTTCCACAGGCCGCATCACCATGCCTAGCTGTATTTTACTTANCATTTCTTTCCTTCACACTTTAAATTTTATTTTG
GGGAGTTTGGGGGTN
Sequence Type genomic DNA
Unitrap ID UNI1985

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 22406907..22407000 92
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000013089 (Etv5) NM_023794 ets variant gene 5 Gene [Source:MGI Symbol;Acc:MGI:1096867]

 
Come back to gene ENSMUSG00000013089


For any suggestions or comments, please send an email to unitrap@crg.es