Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15054H3
Clone ID IST15054H3
Vector VICTR80
Project tigm

Sequence tag IST15054H3HMF1
Sequence
CAAGGTGTGTCTCTAATCCCAGCGAGGATAGGAGAATCTCCAGAGCTCAGGGGTCGGCAAAAATCTCTTGAGTTCCAGGC
TAATGAGAGACCTTTCTCAAGAAGTAGGGGAGACAGTGTCCTGAGGAAGTCCCGACCTGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 141723242..141723381 140
NO GENE  


Sequence tag IST15054H3HMR1
Sequence
NTGCCNACCCAGCTTTTCNAATGTGGGTTCTGGGGATTCGAACTCGGGTCCTTGTGTTTACAACAGGACTGACTGAGCCA
TCATCTCCCCAGCTCTTTCCAGCTTTTGAGCAGAAGTGACCACAGGGATGAGGACTGATCAGACCACTCCTGCACGGGAA
GAGTTGGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTN
Sequence Type genomic DNA
Unitrap ID UNI30040

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 141723032..141723237 204
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040606 (9030409G11Rik) NP_001103155 RIKEN cDNA 9030409G11 gene Gene [Source:MGI Symbol;Acc:MGI:1918779]

 
Come back to gene ENSMUSG00000040606


For any suggestions or comments, please send an email to unitrap@crg.es