Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14998H7
Clone ID IST14998H7
Vector VICTR78
Project tigm

Sequence tag IST14998H7HMR1
Sequence
NNTTTATAGTGGGCTTTGATGCACAAAATTTAAATTTGGTGAAGTCTAGTTTGCCTATTATTACCTTTAATTTTTGTCAA
ATTTGACAAGACCTGGTTGTCAAGTCCTGTCATGAAGATTTTCCCGTATGTTTTCTTTGAAAAGACTTATAGATCATATA
CTTATATATACTTACAGATCATATACTGATATATATTTATAGATTATATATACTTACAGATCATATACTTAGGTTTTGAT
GCACCATGTGTTC
Sequence Type genomic DNA
Unitrap ID UNI3824

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 111028672..111028921 250
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032497 (Lrrfip2) NM_027742 leucine rich repeat (in FLII) interacting protein 2 Gene [Source:MGI Symbol;Acc:MGI:1918518]

 
Come back to gene ENSMUSG00000032497


For any suggestions or comments, please send an email to unitrap@crg.es