Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14953D12
Clone ID IST14953D12
Vector VICTR76
Project tigm

Sequence tag IST14953D12BBF1
Sequence
AGACTAACTTGAGTCTTTTTACATCAAGGCATTATTTATTGTGAAATTGCTTTCCATTCTTCGGGTCCTCGGGCAAAAAT
TTTTAAAAGTTTATGCAACGTGTTTTCCTGGTTAAAACTGTCTAGGCTGCACTAAGGGGAATCCCGGTTTCTAAACAGCA
TGATCTCCCAGGATCT
Sequence Type genomic DNA
Unitrap ID UNI16411

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 43213764..43213938 175
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023915 (Tnfrsf21) NM_178589 tumor necrosis factor receptor superfamily, member 21 Gene [Source:MGI Symbol;Acc:MGI:2151075]


Sequence tag IST14953D12HMF2
Sequence
AAACTATACGACACTTANNANAGCAACTAGACAGTTTGCATTTGTTGCTANNTGANNCATTAACACAAACAAAACCCGTT
ATTCTGGCGAGCTACAAACTGCCGCTTGGCGGTTAAGCATGAATGTGGGGCTGTTAGGGGAAAGGCAGCATAAACTCACT
CAAAAACTACCCCTCAACAACGAAAAAAAGAGAGAATTTTATGTTGCCATTTCTTGTAAGAGGTCAAGAGAAGGGCCAGT
TTGGGGCCTCACACACTTAATAAAGACAATGTCACCATGGGAGCAACTTTTCAGTCCNAACTCGGATAAGAAGCTCGCTG
CGGGTTTTCTTCGCTGTCGGAGCAAATCCNCCGCGCTAANTGATCGCCCACAGCNAAACTCCAGCGAGCGCGGGCTGGCC
CGGCTCTGNNTCCCCGTGCTGGAAACCATGTCCNCCTCAGTCCCCTAATCCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 113521100..113521551 419
 
EST/CDNA Est Name
  BF450905.1 - BY210488.1 - BB409698.2 - BE374583.1 - BF583228.1 - BI688713.1 - CV562721.1 - BQ771089.1 - AW231015.1 - AA014030.1 - BE980197.1 - BG079383.2 - BF181043.1 - BF167279.1 - CA318360.1 - CF724533.1 - BU921628.1 - BY738937.1 - CK621042.1 - BG247695

 
Come back to gene BF450905.1 - BY210488.1 - BB409698.2 - BE374583.1 - BF583228.1 - BI688713.1 - CV562721.1 - BQ771089.1 - AW231015.1 - AA014030.1 - BE980197.1 - BG079383.2 - BF181043.1 - BF167279.1 - CA318360.1 - CF724533.1 - BU921628.1 - BY738937.1 - CK621042.1 - BG247695


For any suggestions or comments, please send an email to unitrap@crg.es