Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_115A7-3
Clone ID CMHD-GT_115A7-3
Vector Gep-SD5
Project cmhd

Sequence tag CMHD-GT_115A7-3
Sequence
TCAGGAGGGAAAAGAACTTTGGAGGGGAACTGCGCATCTCCTTCCAGGAGCCCGGAGGGGAGAGACAGCTGCTCAGCAGC
AGGAAGACCCTAGCAGATTATGGGATATTCTCTAAGGTGAACATTCAAGTGCTGGAGACCTTTCCTCCTGAGATCCTGGT
CTTTGTGAAGTATCCTGGTGGCCAGAGCAAGCCTTTCACCATCGACCCTGATGATACCATCTTAGATCTGAAAGAGAAGA
TAGAAGATGCTGGAGGCCCTTGTGCGGAGGATCAGGTACT
Sequence Type mRNA
Unitrap ID UNI14098

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 115361000..115361279 280
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029561 (Oasl2) NM_011854 2'-5' oligoadenylate synthetase-like 2 Gene [Source:MGI (curated);Acc:Oasl2-001]

 
Come back to gene ENSMUSG00000029561


For any suggestions or comments, please send an email to unitrap@crg.es