Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AF0766
Clone ID AF0766
Vector pGT0lxr
Project sanger

Sequence tag AF0766
Sequence
CACTTATCAACTGCAGGACGGGTGCCTGGGATCCAGCCGCTGGCGGTGTGTGCGGGTCACCGGAGCAGGAGTCCTAGTGT
TGGACTCATGAGAGCAAAGACCATGCTGACAGGAATAACAAGGCTTTTCTCCAGGGTCCAGAAGTTGGACCCGAGGTGTT
TTTTGCACATGAGTGTTCAAGCGACTCAGAACAGTCAGGTTCCAGCTGAGCGTCCCAGAACTGTTTCCCGCACCAGTGAC
AGTGACCCG
Sequence Type mRNA
Unitrap ID UNI2291

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 88740071..88753877 107
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000068921 (Dap3) NM_022994 death associated protein 3 Gene [Source:MGI (curated);Acc:Dap3-001]

 
Come back to gene ENSMUSG00000068921


For any suggestions or comments, please send an email to unitrap@crg.es