Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11392G7
Clone ID IST11392G7
Vector VICTR76
Project tigm

Sequence tag IST11392G7HMR1
Sequence
ATTTNNGTGTGGGACACTGGAGGGGCTATGCCTTAGCCCTGCCTCCTTCCCTCCGAAAACTGCTAGTGCCAATCTCTGTG
CTCTGGGGACATAAACACTCCATCTCCTCCTAGCACACACAGGACAGGGTATCTGTCATCCCCAGCCCATTGGACAAGGA
TTCTCCTGGATGTCTCACCCTAGCCAGT
Sequence Type genomic DNA
Unitrap ID UNI34186

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 58077262..58077449 184
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036986 (Pml) NM_178087 promyelocytic leukemia Gene [Source:MGI Symbol;Acc:MGI:104662]


Sequence tag IST11392G7HMF1
Sequence
AAATCATAGCAAGCACAGGGTAAACCACCANTGCCATATTCAATGGCTGCTCANNNCAGCTCGGGCATGGGAGTCCTGAT
GGCTCTGANTGCCCAGGTGGGATTAGAATGTGGAGGTGGGGCCTGGGGTGTTCCAGATATCTGAGGGCATGACAGTCTTA
CACAGGTGTTCCCTGCCTAATCCTCCTACCTGTTTCCCCTGTGTCACTGGTAACATGATTGTTGTTGGGCAGGAGGATCT
TTTTTTCAGGGACGGTGCTCTCANGGTTGGAAGTCCCATCCAGATGGGGAGGGGAGGTGGCCTTGAAAGTGCTGGGCCAG
GACTGCTCGGGGGANCTTGTGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 58077446..58077787 328
 
EST/CDNA Est Name
  CD565140.1 - CA564043.1 - AA138191.1 - AI324338.1 - CJ139865.1 - BY211618.1 - BI157574.1 - BQ560666.1 - BQ442954.1 - CX207521.1 - CA532529.1 - DT919936.1 - CN531496.1 - DT920618.1

 
Come back to gene CD565140.1 - CA564043.1 - AA138191.1 - AI324338.1 - CJ139865.1 - BY211618.1 - BI157574.1 - BQ560666.1 - BQ442954.1 - CX207521.1 - CA532529.1 - DT919936.1 - CN531496.1 - DT920618.1


For any suggestions or comments, please send an email to unitrap@crg.es