Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10767B12
Clone ID IST10767B12
Vector VICTR76
Project tigm

Sequence tag IST10767B12HMF1
Sequence
CCCTGTCTCGAAAAAACAAAAACAAAAACAAAA

Sequence Type genomic DNA
Unitrap ID UNI18965 UNI21088 UNI34187

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 5416129..5416161 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 17567847..17567879 33
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047786 (Lix1) NM_025681 limb expression 1 homolog (chicken) Gene [Source:MGI (curated);Acc:Lix1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 18434391..18434423 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 16708571..16708603 33
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025370 (Cdh9) NP_033999 cadherin 9 Gene [Source:MGI Symbol;Acc:MGI:107433]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 8200614..8200646 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 52586186..52586218 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 45515018..45515050 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 22182864..22182896 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 33296901..33296933 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 13352856..13352888 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 28271843..28271875 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 8857580..8857612 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 3404223..3404255 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 47839171..47839203 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 130813599..130813631 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 30758249..30758281 33
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037661 (Gpr160) NP_001127857 G protein-coupled receptor 160 Gene [Source:MGI (curated);Acc:Gpr160-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7765902..7765934 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 23386326..23386358 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 53131376..53131408 33
NO GENE  

 
Come back to gene ENSMUSG00000037661


For any suggestions or comments, please send an email to unitrap@crg.es