Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_116D9-3
Clone ID CMHD-GT_116D9-3
Vector Gep-SD5
Project cmhd

Sequence tag CMHD-GT_116D9-3
Sequence
AGCCCCCACCAGGACAGAAGGCCCCCAGAAACTGCCTCATGAAACTCTTCTACGATTGGAAGAGCTGCTCGCCAGTCACA
AGATGCGTTCTGGTCTACTTCCTGACCTACTGGCTTCTGGGACTAATTCTCCATTGCAACTTCCTGCCGTGGACTTGACC
TGGAGTGTCAAGGGTTGAAAGCTCTAAGACGACACCCTGGCTGGGACAGCCCGCACACTCCGGAGAGCACTGTGCAGTAA
GATCTCCTGGTCTCTCT
Sequence Type mRNA
Unitrap ID UNI14099

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 133218326..133218582 237
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000043257 (Pigv) NM_178698 phosphatidylinositol glycan anchor biosynthesis, class V Gene [Source:MGI (curated);Acc:Pigv-002]

 
Come back to gene ENSMUSG00000043257


For any suggestions or comments, please send an email to unitrap@crg.es