Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11552D7
Clone ID IST11552D7
Vector VICTR76
Project tigm

Sequence tag IST11552D7HMR1
Sequence
NGTGAGAGTTTAATGTTTGTACAGGGAGGACCAGGCCTCAGGACTGTTCTTATAGGCTAGGGACCGTAGCAGGGGTGACC
TCAGGATTGTTCTTATAGGCTAGGGACCGCAGCAGGGGTGACAGGATGATGTTCACTTTACAGTGCCTACTGTGTGTCTA
GCGCTGTTCTATATGTTGAACGTTACATCCCAACTTAGGGAAGGGGAGAAGGGGGTCAGGGAACGACAGGAAGTAGCAGA
GTGGGGTTAAGGCTCCATGTGGTCCGACCCATTANAACCCTGCCTGCTGCCTGGTTGGGAAGGGCCCTGANANGTCCTTC
CTTGCCNTTGCCNTN
Sequence Type genomic DNA
Unitrap ID UNI15981

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 4604266..4604596 323
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000014303 (Glis2) NM_031184 GLIS family zinc finger 2 Gene [Source:MGI (curated);Acc:Glis2-001]

 
Come back to gene ENSMUSG00000014303


For any suggestions or comments, please send an email to unitrap@crg.es