Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10958A2
Clone ID IST10958A2
Vector VICTR76
Project tigm

Sequence tag IST10958A2HMF2
Sequence
ATTTATCTATCAAAGGTAGGTAGGTAGTCTGCCNTTGGA

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 51503263..51503300 36
NO GENE  


Sequence tag IST10958A2BBF1
Sequence
NTTGCTCTCACTGCTCTAGCAGAAGATTCAGTTCCGTTCTCAGTGTCAGCTTGACTGCTTATAATCAAATGCAATTCCAG
TTTCAGAGCATCCAGTACTCTCTTCTGATATGAGACTTGCACATGGTACACATTCATACATGCAAGCAAAAGACTCATGC
ATATAAAGGATAAACCTGAAAAAAGATTTAAAAGTGANTATATTTGAGGTATAAAAATGANATAATATCTGGGTGGTGGC
ACATGCCTTTAACCCCAACACCCATGAGGCAGAGGCAGGCANATCTG
Sequence Type genomic DNA
Unitrap ID UNI14329

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 30473139..30473423 279
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039697 (Ncoa7) NM_172495 nuclear receptor coactivator 7 Gene [Source:MGI Symbol;Acc:MGI:2444847]

 
Come back to gene ENSMUSG00000039697


For any suggestions or comments, please send an email to unitrap@crg.es