Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11636G9
Clone ID IST11636G9
Vector VICTR76
Project tigm

Sequence tag IST11636G9HMR1
Sequence
NCCCTCCACTANNNNNAGCCTCAGGAGTTGAGATGGAGGCTTCACATTTGAAACATCTAATCTTATTTAGTGCAAAGGAA
TTCTGGTGGTGGCAACATTTTAAACATGTTTGTCCCCAAACACTCCTGTTATATCCAAACAGTAGGACGGCTTTACCTTC
TCAGCGGCCTGATCTGTGACTTGGAAGGACAGCACATCCATGCTTTGCTCTTANTTACTGATCTGAGTGCCGGAATGGGC
TGGCTGGGCTGCTTTTCTTNNNGTTTCTCGGGGGGGGGGGN
Sequence Type genomic DNA
Unitrap ID UNI10643

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 77798009..77798288 258
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032349 (Elovl5) NM_134255 ELOVL family member 5, elongation of long chain fatty acids (yeast) Gene [Source:MGI (curated);Acc:Elovl5-001]


Sequence tag IST11636G9HMF1
Sequence
GGAGGAGGGGAGGCANTATTTTAGGGCTGGAGGGCATTTTGCACTGGTTAGCATGCACTTGGCANGCGGGGAGCCCTGAA
CGAGTGGGTCCTCGGGACTA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 77797912..77798010 95
NO GENE  

 
Come back to gene ENSMUSG00000032349


For any suggestions or comments, please send an email to unitrap@crg.es