Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14223G7
Clone ID IST14223G7
Vector VICTR74
Project tigm

Sequence tag IST14223G7HMF1
Sequence
ACACGAAACAAAGCAAAGTCACCGGCACCTTGGTGACTTAATTCGCAAATGCTAAGCAGCAGCGTGCAAGTTTATCAGTT
ACACACAATGAAACTCGGTAAATCCCGCGTCTGTTTCAGAGAGGAAGACATGTCAGATTGGTAAATTACCTCAGAGAAAG
CTCGGATAATAACAGGCAGGAGAAAAGCAGCTGTTTTCCCTGAGCCAGTGTCAGCGCTGGCCAGC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 138313899..138314122 224
NO GENE  


Sequence tag IST14223G7HMR1
Sequence
GTGTGTGAAAACATCACTTCAAAGAATATTCCTTTTC
Sequence Type genomic DNA
Unitrap ID UNI23604

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 138314119..138314154 36
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026404 (Ddx59) NM_026500 DEAD (Asp-Glu-Ala-Asp) box polypeptide 59 Gene [Source:MGI (curated);Acc:Ddx59-001]

 
Come back to gene ENSMUSG00000026404


For any suggestions or comments, please send an email to unitrap@crg.es