Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15051H6
Clone ID IST15051H6
Vector VICTR80
Project tigm

Sequence tag IST15051H6HMF1
Sequence
GCTCTTAAAGCAGAACCCGGGAGACTACAGTAACCAGAGATGGACACAATTATCTTCTACCCACAGGAGAACCCATCATT
ACCGGACGCGCGCCACGCGTGGGGGCGGGGAGCGCCCTCGGCCTTGGCGGTTCCCGGGAACGCACCTGCCTCGTACGCTT
CCCAAGTTTCACTCGACCGGGAGCTAGCTGGCACGTCCTGTCTCACCGATGTCTGCCCACAATCCCGGCGAAGTGACACT
CGAGGCGACCTTCCCCTAATCCCACAGCTACGGGGAGGTCAGGGGTGACCAGAGTTTCCCCCCAACAACGCGCGAGACCC
CGGCGACGCGCCCGGCCCTCAGCGGCCACCGCGCGGTATCGCCCGAAACTCAGCGCCCAGCCCCATTGGCCGTCGCCGCC
ACTCCCCTCCCAGCCCGCGGCGTCNCCCGGGGAGCCNGGCCNNCCACCCGGCACGGTCGANAGCCTCGGCTCANTGAGCN
NGNCNAC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 121544849..121545327 467
 
EST/CDNA Est Name
  BB619482.1 - BY720059.1 - BY722349.1 - BB626753.1 - BF140866.1 - BB630094.1 - BB635858.1 - BY732896.1 - BB619391.1 - BB612644.1 - BY737035.1 - BE532310.1 - CF170686.1 - CF170648.1 - CA542347.1 - BI143781.1 - AV015509.2 - CA540766.1 - BB609720.1 - BB857626


Sequence tag IST15051H6HMR1
Sequence
GAGCGAGAAGGCTCCAGGCTCCGAAGTTGTTTAGCAATAGTTCAAAATTACTAGTAATGGTTTTTTTTTTTCCCNTNAA
Sequence Type genomic DNA
Unitrap ID UNI24432

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 121544774..121544852 73
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026383 (Epb4.1l5) NM_145506 erythrocyte protein band 4.1-like 5 Gene [Source:MGI Symbol;Acc:MGI:103006]


Sequence tag IST15051H6BBF1
Sequence
GCTCTTAAAGCAGAACCCGGGAGACTACAGTAACCAGAGATGGACACAATTATCTTCTACCCACAGGAGAACCCATCATT
ACCGGACGCGCGCCACGCGTGGGGGCGGGGAGCGCCCTCGGCCTTGGCGGTTCCCGGGAACGCACCTGCCTCGTACGCTT
CCCAAGTTTCACTCGACCGGGAGCTAGCTGGCACGTCCTGTCTCACCGATGTCTGCCCACAATCCCGGCGAAGTGACACT
CGAGGCGACCTTCCCCTAATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 121544849..121545109 261
 
EST/CDNA Est Name
  CJ185282.1 - CJ087376.1 - BY066312.1 - CJ079086.1 - BY027926.1 - BY299151.1 - BY067290.1 - BY126950.1 - BY110925.1 - BY110975.1 - BY005689.1 - BB843750.1 - BY034585.1 - BI143781.1 - BY732896.1

 
Come back to gene CJ185282.1 - CJ087376.1 - BY066312.1 - CJ079086.1 - BY027926.1 - BY299151.1 - BY067290.1 - BY126950.1 - BY110925.1 - BY110975.1 - BY005689.1 - BB843750.1 - BY034585.1 - BI143781.1 - BY732896.1


For any suggestions or comments, please send an email to unitrap@crg.es