Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_101D6-3
Clone ID CMHD-GT_101D6-3
Vector pGT6
Project cmhd

Sequence tag CMHD-GT_101D6-3
Sequence
TATCTCGCGGAGTTTTTCAGTGTGATGCTCCACTCGGAGACATCTCCCCTTCACATCAACAAAGTGGGACTGACCCTGTC
CTAGCACACCACTTGTGAATTCTCACCATTCTTCAAGAAAGGAGTTTTTGACTACAGCAGCCATGGGACAGGGTAGAGCT
GTGGCGACCAAGGAACCACCAACACAGTGCCTTCTCATCATATAGACTCTGATGCAGAGTGGACTCCTGCACCAGGATTC
CAGCTTGCCTCCTCCAGTTGTGGCAACATGCAGCAGCCAGCCCAGACCACCTCTCACACCATATCTAGTGCCTGAGTTTG
GGAGTGGGTGCTTGCCTGCCAAGGGCAACTCTGATTGACAGTTGTTACTGTACCTCTGCACTTGAACGTGGCCCTTCCCA
TAGTACAGCAAGTCAATCCCCTGT
Sequence Type mRNA
Unitrap ID UNI14104

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 142445226..142445649 406
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038844 (Kif16b) NM_001081133 kinesin family member 16B Gene [Source:MGI (curated);Acc:Kif16b-001]

 
Come back to gene ENSMUSG00000038844


For any suggestions or comments, please send an email to unitrap@crg.es