Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12253E7
Clone ID IST12253E7
Vector VICTR76
Project tigm

Sequence tag IST12253E7HMF1
Sequence
GCTCTAGAGCTCTGTATGCATTGACTTGATGCTCTTGCCCCTGTGCAGGCTGCCTGTGTGGA
Sequence Type genomic DNA
Unitrap ID UNI34196

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 14537964..14538024 61
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036912 (Piwil4) NM_177905 piwi-like homolog 4 (Drosophila) Gene [Source:MGI (curated);Acc:Piwil4-001]


Sequence tag IST12253E7BBF1
Sequence
GCTCTAGAGCTCTGTATGCATTGACTTGATGCTCTTGCCCCTGTGCAGGCTGCCTGTGTGGCCAGATAACCACATCAGTT
CTGAATGTAGGACTACTCTTTCTTTCGTCGTATCACTAATTGTAGGAAAGACGAGTTACTGATGCCAGGTCTAAGAGTGT
TTGCAAAATGAGACCATTGAAGTAGTTAAATGTTTAATCTTCATTTACCCCCACCTTCAGATTTTCAAGATTGTCAGTCC
CCAGACAGCTATCAATATGCATGGCTCTCTCAATATTCTGTTTTAAAATAAGACTGGAGCTACTAAGAGAGAAAGAACCA
GGTTTCTAAAAGTTAGTAGAACAGAGTTAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI34196

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 14537671..14538024 354
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036912 (Piwil4) NM_177905 piwi-like homolog 4 (Drosophila) Gene [Source:MGI (curated);Acc:Piwil4-001]

 
Come back to gene ENSMUSG00000036912


For any suggestions or comments, please send an email to unitrap@crg.es