Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10873D4
Clone ID IST10873D4
Vector VICTR76
Project tigm

Sequence tag IST10873D4HMR1
Sequence
CTTAAATGCTGGAATTACAACATGAATTCCAGCACAAGGCTTATTGTTTCTGTTTTTAAGACATGGCTGGGGATGCAGCT
CAAGCTAGCCTTGAACTCACAACAATCCTGCCTCAGGAAACCTTAGGCCTGAAACCACAGACAAGAGCTACCACACCTGG
CTTATCCCCATGCCCCAATAGACTGAACCCAGAGCCACATTCATGATAGGAAGGTGTTCTATCCCTGAGTGGTAACCTTG
GCTTTTTTTTTTTTTTTTTTTA
Sequence Type genomic DNA
Unitrap ID UNI32064

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 3399474..3399734 261
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053395 (Cacng8) NP_573453 calcium channel, voltage-dependent, gamma subunit 8 Gene [Source:MGI Symbol;Acc:MGI:1932376]

 
Come back to gene ENSMUSG00000053395


For any suggestions or comments, please send an email to unitrap@crg.es