Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10024G4
Clone ID IST10024G4
Vector VICTR75
Project tigm

Sequence tag IST10024G4BBR1
Sequence
CCAGCAACCACATGGTGGCTCACAACCATCCATAACAAGATCCGT
Sequence Type genomic DNA
Unitrap ID UNI29416 UNI30839 UNI30840 UNI30841 UNI32550

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 16975923..16975964 42
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 5934066..5934107 42
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019763 (Rmnd1) NM_025343 required for meiotic nuclear division 1 homolog (S. cerevisiae) Gene [Source:MGI (curated);Acc:Rmnd1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 5406636..5406677 42
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 3520402..3520443 42
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 37024558..37024599 42
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 31526388..31526429 42
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 38101170..38101211 42
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 11263870..11263911 42
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 24924569..24924610 42
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 38507026..38507067 42
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 3491912..3491953 42
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 11497788..11497829 42
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 9230293..9230334 42
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 43636239..43636280 42
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 18990771..18990812 42
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040003 (Magi2) NM_015823 membrane associated guanylate kinase, WW and PDZ domain containing 2 Gene [Source:MGI (curated);Acc:Magi2-003]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 29817693..29817734 42
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029772 (Ahcyl2) NM_021414 S-adenosylhomocysteine hydrolase-like 2 Gene [Source:MGI (curated);Acc:Ahcyl2-002]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 16431945..16431986 42
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 3519309..3519350 42
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000004565 (Pnpla6) NM_015801 patatin-like phospholipase domain containing 6 Gene [Source:MGI Symbol;Acc:MGI:1354723]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 3384158..3384199 42
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025899 (Alkbh8) NM_026303 alkB, alkylation repair homolog 8 (E. coli) Gene [Source:MGI Symbol;Acc:MGI:1914917]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 45908448..45908489 42
NO GENE  


Sequence tag IST10024G4BBF2
Sequence
CTGGGATTTGAACTCTGGACCTTTGGAAGAGCAGTCGGGTGCTCTTACCCACTGAGCCATCTCACCAGCCCTTATTATGC
ATTTTAATTAAGATTTAATTACACCAAAAGAATTTAGACTGACCAATTCAGAGTCTGCCGTTTAAAAGCATAAGGAAAAA
GTAGGAGAAAAACGTGAGGCTGTCTGTGGATGGTCGAGGCTGCTTTAGGGAGCCTCCTCACCATTCTGCACTTGCAAACC
GGGCCACTAAAACCCGGTGAAGGGAGAAACCAAAGCGACCTGAAACAATAGGTCACATGAAGGCCAGCCACCTCCATCTT
GTTGTGCGGGAGTTCAGTTAGCAGACAAGATGGC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 74916993..74917275 269
 
EST/CDNA Est Name
  AA516792.1 - AA403882.1 - AA896812.1 - AA794093.1

 
Come back to gene AA516792.1 - AA403882.1 - AA896812.1 - AA794093.1


For any suggestions or comments, please send an email to unitrap@crg.es