Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14999B6
Clone ID IST14999B6
Vector VICTR78
Project tigm

Sequence tag IST14999B6HMF2
Sequence
GTTACACCCTGCAAACCACAAACTTTGAATAAACATCAAGAACATTCTTGTTCCTTCCACAAATGTTAAAATTTTCCACA
TAGACAAAGATTTCTGCATGAGACCCAATAGAAGAATTAGCATAAGACTCCTGTTAGGAATGCACTGTAAGTTTATGCCA
CAATTACTATCTTTGATCTAAGGTACCAAGGATGGACAAAATAAAAGTGAGGAAACAAAATACATATATATAGTCATGCT
AAAAAACACAATAAGAATTTGCCATTCAGAGATGGAGCAGAAAACAGATTGAAACAGAACCTAAAGGAGTGCAGGCAAGG
CAAGGAATCAAAGCTGGATTCACTGCTTAAAGATGGGGTCCAGGGAGAAGACATCATCCNCTCTACATCTTTGGAANGGG
ACTCANGAAAAAAATAAACTGACCGCNGCCTANCTNACACNAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 23176081..23176520 428
NO GENE  


Sequence tag IST14999B6BBF1
Sequence
ATACATTAAACACACACACACATACACACACATGCAATACACACATCTGGACACACATACTGTAAGTATGAATATCTACA
TGGGTGTGTGTGGCACGCGCATGCCTAGTGCCCGTGGAGGCTAGGTGAGGGCACCAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI30157

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 135208361..135208501 141
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028164 (Manba) NM_027288 mannosidase, beta A, lysosomal Gene [Source:MGI (curated);Acc:Manba-001]


Sequence tag IST14999B6HMR1
Sequence
ATTCTGTGTTGATTTTTGTTTGTTTGTTTGTTTGTTTGTTTGTGGCCTTGTTTCTAATTATGTGCCTCACCAAAGGGAGT
GGTAGTGGCAAGCCCCCAGCCATTACAGGGTAACCCATTGCCTAATTGCAGAGATGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 23176521..23176659 135
NO GENE  

 
Come back to gene ENSMUSG00000028164


For any suggestions or comments, please send an email to unitrap@crg.es