Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_106E1-3
Clone ID CMHD-GT_106E1-3
Vector Gep-SD5
Project cmhd

Sequence tag CMHD-GT_106E1-3
Sequence
CAGCCCAAGTCTGACCCCTTGGTCACTCTGTTCCTGCCTTCCTTAAAGAATCTTCAGGCCAACAAGGCCACACTAGTGTG
TTTGGTGAGCGAATTCTACCCAGGTACTTTGGTGGTGGACTGGAAGGTAGATGGGGTCCCTGTCACTCAGGGTGTAGAGA
CAACCCAACCCTCCAAACAGACCAACAACAAATACATGGTCAGCAGCTACCTGACACTGATATCTGACCAGTGGATGCCT
CACAGTAGATACAGCTGCCGGGTCACTCATGAAGGAAACACTGTGGAGAAGAGTGTGTCACCTGCTGAGTGTTCTTAGAC
CACAATCCTCCCTGAAGCCTCNAGGGCCTGGATCTGAAGTGCCAGAAAAA
Sequence Type mRNA
Unitrap ID UNI12791

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 16860856..16861225 366
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000075370 (Igll1) immunoglobulin lambda-like polypeptide 1 Gene [Source:MGI Symbol;Acc:MGI:96529]

 
Come back to gene ENSMUSG00000075370


For any suggestions or comments, please send an email to unitrap@crg.es