Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12098E2
Clone ID IST12098E2
Vector VICTR76
Project tigm

Sequence tag IST12098E2HMF1
Sequence
ATATCTGAAAATCTTTCGTTCCTTTCTTTCTTCCTTCCTTCCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTT
Sequence Type genomic DNA
Unitrap ID UNI31077

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_165789: 257698..329191 58
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079834 (Tmlhe) NP_620097 trimethyllysine hydroxylase, epsilon Gene [Source:MGI Symbol;Acc:MGI:2180203]

 
Come back to gene ENSMUSG00000079834


For any suggestions or comments, please send an email to unitrap@crg.es