Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_106C4-3
Clone ID CMHD-GT_106C4-3
Vector Gep-SD5
Project cmhd

Sequence tag CMHD-GT_106C4-3
Sequence
GGCTACTCAATACTCCTCATCCCTGGCTTCGCAGCCCTCCCGAGAAGGCATGGTGACCAGCCGCCAGGTGCGCACCATTG
TGGAGGAAGTCCAGGATGGTAAGGTGGTCTCCTCCAGAGAGCAGGTGCACCGCTCCACCCACTGAGGCCCCTGTCTGCGT
ATGATAGCCCAGGCCCAGGACCTTAGGCTGCAGCTCCCTGCATCTACTGCCAAGCCTGAACTCCTATGAGCTAGCTGTTG
CCTTCTGTGTTTGCTTTGTGCTGCCCCTTACAGAGAGGCCCCTTGGGTTGACCCC
Sequence Type mRNA
Unitrap ID UNI14057

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 100124234..100124654 250
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053654 (Krt42) NM_212483 keratin 42 Gene [Source:MGI (curated);Acc:Krt42-001]

 
Come back to gene ENSMUSG00000053654


For any suggestions or comments, please send an email to unitrap@crg.es