Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AF0383
Clone ID AF0383
Vector pGT0lxr
Project sanger

Sequence tag AF0383
Sequence
TCAATGCTTTGTACAGTCTAGGTCTCCCCGGCAGTGGCGATGGCTTCCTCACGGGGCTGGCCACAGGCACAACCCTGTGC
CAACATGCCAACGCTGTCACCGAGGCTGCCCGGGCTCTGGCTGCTGCCCGTCCAACCCGAGGTGTGGCCTTCCAGGCACA
CAGTGTGGCGCCTGGCTCCTTCATGGCCCGAGACAACGTGGCCTCTTTCATCGGCTGGTGCCGGGCTGAGCTGGGCGTGC
CTGAAGTGCTCATGTTTGAGACAGAGGACCTGGTGCTACGCAAGAACGAGAAGAGTGTGGTGCTCTGCCTGCTGGAGGTC
GCCCGGCGTGGGGCGCGCCTTGGCCTGCTTGCCCCGAGGCTGGTACAGTTCGAGCAGGAGATCGAGCGGGAGCTTCGAGC
TACCCCTCAGGTTTCCAGCGTCCCTGCTGCTGAAGAGGATGTCACTGAAATTGCCACTGTACCAGGGGTTCCCACCCGCA
CACCCCGCATGACGCCCAATGACCTTCGAAACCTTGATGAGCTG
Sequence Type mRNA
Unitrap ID UNI2298

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 4963829..4964352 524
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034201 (Gas2l1) NM_144560 growth arrest-specific 2 like 1 Gene [Source:MGI (curated);Acc:Gas2l1-003]

 
Come back to gene ENSMUSG00000034201


For any suggestions or comments, please send an email to unitrap@crg.es