Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14239A8
Clone ID IST14239A8
Vector VICTR74
Project tigm

Sequence tag IST14239A8HMF2
Sequence
CTTCGAGAGAAATTAATGGAGACCAAGNCATGATTCTGTTCAAGGCCCGCCAGTTTACTAAGAGAGTGTGCTCATAACAG
GGAAGGCCCATCCCCTGCCAGTCCATTTCTGGTGTCTGGAGCCAGCCTGTAGGCGACTTGCAGGATAGGGTGTTCTTCAG
GTATATCTCAGCGGCCTCTCAGCAGGTAGCAGTGTCTTGGAGGAGCAGTGGCAGGTGGCAGAACAATANAGCCNTCTNNG
CNGGAAGGCTCCACCCCANGTAATCTCCCTAGTGGCCTCAAGGTCAAGGTCTGGATCAGCTTGTTTCANGCTGGGGGAGG
TTACNNCTTATGGCACTGNTGTCCCCTCCCTCNACAAAAATAAATAANTGTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 155044357..155044727 345
NO GENE  


Sequence tag IST14239A8BBF1
Sequence
AAAGTAAGGATAAGAAGGATAGAGGGGTAGACCAGAGACAGAGCGGAGGTGAGGGTGGGGGAGGGGANAGAGANAGTTGA
TGATCCTTGAATCTAATGTCTTTCTTCTTGTTTCTTCTCTGCTTGNNNTTGGTCTTTGCTGCTTTATANGTTCTTTTCCC
CNCTTTTATTTTTTCTTCTTCNTCGAGACNNGGTTTCTCNGTGTNNCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14239A8HMR1
Sequence
GAAGTCTAGTCTCTTTCNGCCCCAGCCTGCCTCCCAGGTGTAGGCCCAAGTGGGCCGCGGGCCGGTATACAACAATAACC
TACATGTGCAGTCAGAGGCTCATGCAAGCGTCTTTGCCTGCTAAGTNATTTTACAGGCTATTTTTATTTTGAGACAGCAT
CTTACTTTTGCCCAGGTTC
Sequence Type genomic DNA
Unitrap ID UNI30506

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 155044724..155044901 174
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042202 (A530082C11Rik) NM_177186 RIKEN cDNA A530082C11 gene Gene [Source:MGI Symbol;Acc:MGI:2444240]

 
Come back to gene ENSMUSG00000042202


For any suggestions or comments, please send an email to unitrap@crg.es