Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12301A9
Clone ID IST12301A9
Vector VICTR76
Project tigm

Sequence tag IST12301A9BBF1
Sequence
CCAGGACAGCCAGGGCTATACAGAGAAACCCTATCTCA
Sequence Type genomic DNA
Unitrap ID UNI33476 UNI34203 UNI34204

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166311: 102170..102207 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 10252638..10252675 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 29818191..29818228 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 17007149..17007186 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 82894650..82894687 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 8094780..8094817 38
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022142 (Nup155) NM_133227 nucleoporin 155 Gene [Source:MGI Symbol;Acc:MGI:2181182]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 9293336..9293373 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 12959324..12959361 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 3840487..3840524 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 21061121..21061158 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 27356879..27356916 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 51001290..51001327 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 4639093..4639130 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 39138525..39138562 38
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042599 (Jhdm1d) NP_001028602 jumonji C domain-containing histone demethylase 1 homolog D (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:2443388]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 50278007..50278044 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 8779868..8779905 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 6387631..6387668 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 14087290..14087327 38
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039717 (Ralyl) NP_848746 RALY RNA binding protein-like Gene [Source:MGI Symbol;Acc:MGI:1924147]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 58801711..58801748 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 16732899..16732936 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 26391797..26391834 38
NO GENE  

 
Come back to gene ENSMUSG00000039717


For any suggestions or comments, please send an email to unitrap@crg.es