Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14473D11
Clone ID IST14473D11
Vector VICTR74
Project tigm

Sequence tag IST14473D11HMR1
Sequence
TACCNTTACCCACTGAGCCATCTTACCAGCCCTTTACGCACAAGGCTGAAGAGCTGGTGGGTTTCCACTCATTTTAGTGA
TACTTGTTTCATTTATGAGCAAAGGGCTCAAGGGATGAAGATCCGAGCTGGGACCCTCTGGATTGCTCAAATCAGGGTTC
CTTTCATGACCTGATTTTCCAACTTANTACATCATTAGAACCACCCGAAGGCCCTTGGTCACGTGATGCTCTTGGTCACA
TGANACCTCCACCATCTNANATGGTTGCATCAATATTTTCCCTGTCNTTANNCTTGTGTGTCTTCNGTGTGTANCCTANG
CTTTCCCN
Sequence Type genomic DNA
Unitrap ID UNI32677

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 37930104..37930430 305
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039087 (Rreb1) NM_001013392 ras responsive element binding protein 1 Gene [Source:MGI Symbol;Acc:MGI:2443664]


Sequence tag IST14473D11BBF1
Sequence
GTACTTGCCAGCAAGCCAAACAACCTGGGTTCCATCCTAGGGACCCACATCGTTAAGANANAACTAATGATTCCCATGCT
GTCCTCTGATCTTCNCACATGTGCTATAGCATGAAGGCCACACTCAAAAATAAATGCAACTTAACTCCTCTGAATACTGC
TCANAAGCTCANANAACAAATTGTTCCTGCTCCCTTTAAGATGAGGAAATTAGAGAGGAGATAGAANANAANANAGAAGA
AAAGATCCTACTTAACAAGTCCCGCTCATGAGACCTCCCATGCTTCATCTATGCCAGGCACATACTTCTTAACCCAATAA
ACATTACAGGTAAACAAAAAAAATTTTTTTTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 37929755..37930106 332
NO GENE  


Sequence tag IST14473D11HMF1
Sequence
GTACTTGCCAGCAAGCCAAACAACCTGGGTTCCATCCTAGGGACCCACATCGTTAAGAGAGAACTAATGATTCCCATGCT
GTCCTCTGATCTTCACACATGTGCTATAGCATGAAGGCCACACTCAAAAATAAATGCAACTTAACTCCTCTGAATACTGC
TCAGAAGCTCAGACAACAAATTGTTCCTGCTCCCTTTAAGATGAGGAAATTAGAGAGGAGATAGAAGAGAAGAGAGAAGA
AAAGATCCTACTTAACAAGTCCCGCTCATGAGACCTCCCATGCTTCATCTATGCCAGGCACATACTTCTTAACCCAATAA
ACATTACAGGTAAACAAANAAAATTTTTTTTTAAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 37929752..37930106 353
NO GENE  

 
Come back to gene ENSMUSG00000039087


For any suggestions or comments, please send an email to unitrap@crg.es