Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14635B2
Clone ID IST14635B2
Vector VICTR74
Project tigm

Sequence tag IST14635B2HMF1
Sequence
CTGTAAAATATAACTTTAAAGTGAAAAAAGAAAAACACCACACACAAAACCCACTTTCCACCTCGTAATTTACCCCACTC
ATGGATTGGGGAAAGAGTGTCACTGTGGCAAGGACCTGAAGGCTGTAAAGCTTTTCAGACCGCGGTCAGATACCCAGGCT
CCTACGGAGCTCAGTATAAATCTTCATAAACAAGTGTGAAAACTTGTGTGGTCGGCGGGCAGGCTTCCCGGCAACCTACC
CTAGCATCTTCTGCAAACCACAACCCTCCCCTTCGAGGGCTGGCGGAGCCTGACCTTGGGCAATTGGGAAGCCGGGGAAG
CTTCANCTCGGACGCCGCCAGGCTCAGAGACTTCCGGCGTCCCGTGCNANCGCCCGCTGCTGGACTTTCCTTCCNGTNCN
CCNGGTGCNCNCCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 34725234..34725647 396
 
EST/CDNA Est Name
  NM_025471.1 - AK005941.1


Sequence tag IST14635B2HMR1
Sequence
TAAAAACGATAGAGTTTATTTTTTAAAATCTAAGCGATCTCATTTCCCCACTGTGAGACAGGGGGCTGGCTGTCTTGGAA
CTCGTTCTGTANACAAAGCTGGCCTGGAGCTCAGAGAGATCCGCCTGCCTCTGCCTCTCTAGTGCTGGGCTTATCTTAGG
GTCCTGCGTCTGGTANTACTTTATAAATGCAAAACACTTTCCTCAAAAATCANTTTTGGAAAAAGATGCTGATGGAATAN
GANTCCNCTACNNTGGGAANAATTGGATTATCCTACCCTANTANTGAAAAGGCATCGAAGGTANGAAGGTTGCACACTAT
CTGTAGGATGACCGCTATTN
Sequence Type genomic DNA
Unitrap ID UNI30172

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 34724895..34725233 315
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028295 (1810030N24Rik) NM_025471 RIKEN cDNA 1810030N24 gene Gene [Source:MGI Symbol;Acc:MGI:1913541]


Sequence tag IST14635B2BBF1
Sequence
CTGTAAAATATAACTTTAAAGTGAAAAAAGAAAAACACCACACACAAAACCCACTTTCCACCTCGTAATTTACCCCACTC
ATGGATTGGGGAAAGAGTGTCACTGTGGCAAGGACCTGAAGGCTGTAAAGCTTTTCAGACCGCGGTCAGATACCCAGGCT
CCTACGGAGCTCAGTATAAATCTTCATAAACAAGTGTGAAAACTTGTGTGGTCGGCGGGCAGGCTTCCCGGCAACCTACC
CTAGCATCTTCTGCAAACCACAACCCTCCCCTTCGAGGGCTGGCGGAGCCTGACCTTGGGCAATTGGGAAGCCGGGGAAG
CTTCANCTCGGACGCCGCCAGGCTCANAGACTTCCGGCGTCCCGTGCGANCGCCCGNTGCTGGACNTTCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 34725234..34725622 379
 
EST/CDNA Est Name
  NM_025471.1 - AK005941.1

 
Come back to gene NM_025471.1 - AK005941.1


For any suggestions or comments, please send an email to unitrap@crg.es