Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14679H4
Clone ID IST14679H4
Vector VICTR74
Project tigm

Sequence tag IST14679H4BBF1
Sequence
TCTGCCCTCTGTANCACTCTAAGCTCANGTTGATCCACTCATTCCACTTCGGCTTCTATTCTTGGTGATCATCCCATGGT
ACTGCCACTCCCTGTCCAAGAATATACAAACNATTACACCGGCTAACGGCCCCTGTCTCTACACCAATACAGGAGGATCT
Sequence Type genomic DNA
Unitrap ID UNI34208

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 118119992..118120150 153
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030110 (Ret) NM_001080780 ret proto-oncogene Gene [Source:MGI Symbol;Acc:MGI:97902]


Sequence tag IST14679H4HMF2
Sequence
AAACCATTAAACCAACCAAACAGGACGGAAAAAAAACAAAACAGTGAGGCACATGGACAAGCCATAAATCCAGGCACTCA
GGAGGCAGAGGCAGACAGATTTCTGTGAGTTCAAGGCTAGCCTGGTCTACAAATTGGGTTCCAGGTTACCTAGGGCTACA
TAACAAGACCTTGTCTCTAAAGAAATCCCTTACCTTCCCACCCCTACACCCGTGAAAATGTTTGGTAGAACATTTAGCCA
GGTCTAATGGTTCATGCTTTTGATCTTAGCACGCCAGTGGATACAGGAGCAGTTCAAGGACATCCTCTGCCACAGAAGGT
GCAAAGCCAATTTGGGCTACATGAGATCCTCTCAGAAAAGTAAAGGGAGTGCTACAGGGTCCCTGANGATTATCCNNGCA
GTTAGTNAATGGTTGCTGGGGGAAAGAAAGACATTTGGTTGTGGNCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 86471425..86471871 437
NO GENE  

 
Come back to gene ENSMUSG00000030110


For any suggestions or comments, please send an email to unitrap@crg.es