Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14976D10
Clone ID IST14976D10
Vector VICTR76
Project tigm

Sequence tag IST14976D10HMF1
Sequence
TTATGCTGGAAATTTCAACCAATAAGATAAAACTTTAATAAAAATCAATTACAACACCACTTACATAGAGAAGTTACATC
CTATCAACACCATCAATGCAAATTAAAAGAAGAGTGTAGTTTGGCGTCCTAATTTTAAAGAAGACCTGAGTGTTTTAGGG
TTTGCTTGTTTGGGATTTGTTTTGTTTTGTTTTTGTAGTAGGAATTATAGTCAAGGCCTTGTTCATGCTAAGCAATTGAT
TACCACTAAGCTATATCCACAGCCCATAAACAATACTTTCTTGCTAGGGAATTTTAAGTTAATCTGCACTTAAACAGACT
TGGATTTTGTTNNANATTTGGTTNNNGNANGTTNNTTANATNANNTNTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 110017098..110017457 338
 
EST/CDNA Est Name
  CN669541.1 - CN671705.1 - BB851705.1 - AA171096.1 - BY274609.1 - CJ151389.1 - AI789271.1 - BY249109.1 - BB846569.1 - BY280970.1 - BB853109.1 - BY240815.1 - BY005995.1 - CJ175657.1 - BB839791.1 - BB840429.1 - BB844242.1 - BY268738.1 - BB856330.1 - BY245829


Sequence tag IST14976D10HMR1
Sequence
ATACCTGGGGAAGAGGAGGTCATATTGTGGTTTTGAAAGATCAAGCCCTTTACTGCCCACATCCCCACAAGTGTGAATGA
AAGGGACTAGCAGTCAGGAACAGGAATATAGGCCCTCCTAGTCTCCTAGCAATGTTAGATATTGACCTAATGTGCAAAAC
ATTATGTANATTTTTTTAAAACTAAATTTAGTAAGGGTTACTGGACTTAATCCTATTCCAGGAGTGTTATCGTTAANAAN
ATCTCTAAATATGAGTTTGAATACTTTACAAAACAGTATTACTAAATTATATGTGTTACTTTCCCTGTACTCTCTAAATA
GAGTCCTCAGTTAATAGGCATGGTGGCACACACTTGTCATTCTTTCACTTGGAAGGCANATGGANGANGATCAGAGTTCN
NAAAGTGAAGCAAATTAANGGAAAAAAAAAAAAAAAAAAAAAA
Sequence Type genomic DNA
Unitrap ID UNI23118

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 110016659..110017100 422
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032480 (Dhx30) NM_133347 DEAH (Asp-Glu-Ala-His) box polypeptide 30 Gene [Source:MGI Symbol;Acc:MGI:1920081]


Sequence tag IST14976D10BBF1
Sequence
TTATGCTGGAAATTTCAACCAATAAGATAAAACTTTAATAAAAATCAATTACAACACCACTTACATAGAGAAGTTACATC
CTATCAACACCATCAATGCAAATTAAAAGAAGAGTGTAGTTTGGCGTCCTAATTTTAAAGAAGACCTGAGTGTTTTAGGG
TTTGCTTGTTTGGGATTTGTTTTGTTTTGTTTTTGTAGTAGGAATTATAGTCAAGGCCTTGTTCATGCTAANCAATTGAT
TACCACTAANCTATATCCACAGCCCATAAACAATACTTTCTTGCTAGGGAATTTTAAGTTAATCTGCACTTAAACAGACT
TGGATTTTGTTTTAAATTTGGTTTTTGGAGGTTTTNNAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 110017098..110017451 350
 
EST/CDNA Est Name
  CN671705.1 - BB851705.1 - AA171096.1 - BY274609.1 - CJ151389.1 - AI789271.1 - BY249109.1 - BB846569.1 - BY280970.1 - BB853109.1 - BY240815.1 - BY005995.1 - CJ175657.1 - BB839791.1 - BB840429.1 - BB844242.1 - BY268738.1 - BB856330.1 - BY245829.1 - BY251721

 
Come back to gene CN671705.1 - BB851705.1 - AA171096.1 - BY274609.1 - CJ151389.1 - AI789271.1 - BY249109.1 - BB846569.1 - BY280970.1 - BB853109.1 - BY240815.1 - BY005995.1 - CJ175657.1 - BB839791.1 - BB840429.1 - BB844242.1 - BY268738.1 - BB856330.1 - BY245829.1 - BY251721


For any suggestions or comments, please send an email to unitrap@crg.es