Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AF0021
Clone ID AF0021
Vector pGT0lxr
Project sanger

Sequence tag AF0021
Sequence
CTGGTCCCCCTTCGCCCCTAAGNGGTATCTGTTACCCTTACTTACTCTTGGCTCTTGAAGCAGTCGCCCAACGCTAGAGT
GGGACCCAATCTGAGCACCCGGTTCTCCGGAGTCCTTGCCGAAGTGTACTGCGCGCTCAGAGCAGCCCGACAGTTTCCAG
CCAAACTTCACCAACTCCTCTGCCCTTGCCGCCACCATGCCGAAGACGATCAGTGTGCGTGTCACCACCATGGATGCAGA
GCTGGAGTTTGCCATTCAGCCCAACACCACTGGCAAGCAGCTGTTTGACCAG
Sequence Type mRNA
Unitrap ID UNI2303

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 93291433..93337287 153
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031207 (Msn) NP_034963 moesin Gene [Source:MGI (curated);Acc:Msn-001]

 
Come back to gene ENSMUSG00000031207


For any suggestions or comments, please send an email to unitrap@crg.es