Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13600F10
Clone ID IST13600F10
Vector VICTR74
Project tigm

Sequence tag IST13600F10HMF1
Sequence
CCCTCTTTATTTGTAATCCCCTAACTTGTAACCCTGTCACCCAGGGAGGTTAGACAACACTCATTCCCTGGTGTCTTTTG
GCTCACTGATCAGTCANAACCCAGCCTGAAAGCAGCTGTAGGAATGTTTTCCNAGCCCTGGGCAGCANAGGCAGGATTCG
GAGTTCAAAGCAAGTCTTTACTCCATGGCATAAAGAAAAAGCTACAGGANATGTTTCTCTANNCNNANNNAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 177571837..177572057 213
 
EST/CDNA Est Name
  CA883508.1


Sequence tag IST13600F10BBF1
Sequence
CCCTCTTTATTTGTAATCCCCTAACTTGTAACCCTGTCACCCAGGGAGGTTAGACAACACTCATTCCCTGGTGTCTTTTG
GCTCACTGATCAGTCANAACCCAGCCTGAAAGCAGCTGTAGGAATGTTTTCCAAGCCCTGGGCAGCAAAGGCAGGATTCG
GAGTTCAAAGCAAGTCTTTACTCCATGGCATAAAGAAAAAGCTACAGGAGATGTTTCTCTAANCNNACNNANNNGANATC
TCTTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST13600F10HMR1
Sequence
AGGGACAGGTATAAGGTTGAGTTCACTGACCAACTTTGAAGCTGGTCTACTTGCAGCACAGAAGAGGAGGAGGAATAAGG
TAGGTGAGGCCTTTCTGCTTTGGCAGTAGTTC
Sequence Type genomic DNA
Unitrap ID UNI6522

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 177571730..177571840 111
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078863 (OTTMUSG00000016325) predicted gene, OTTMUSG00000016325 Gene [Source:MGI Symbol;Acc:MGI:3702875]

 
Come back to gene ENSMUSG00000078863


For any suggestions or comments, please send an email to unitrap@crg.es