Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11585E1
Clone ID IST11585E1
Vector VICTR76
Project tigm

Sequence tag IST11585E1HMR1
Sequence
CTTCTTTGGAGTCTATACACTAATATAGATATACATATAGACTGTTAGCTTTTTAAAAAATTATCTTTTATTATGTGTGT
ATGGAGGTCAGAGGTCC
Sequence Type genomic DNA
Unitrap ID UNI12168

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 55703722..55703817 96
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040721 (Zfhx2) NM_001039198 zinc finger homeobox 2 Gene [Source:MGI Symbol;Acc:MGI:2686934]


Sequence tag IST11585E1HMF1
Sequence
GAGACAGAAAATAGACTTTGCGCTGGAAGTATAGGCGTANCAATACCTCANCACCAAAAGAGAAGGGAAACCTCAGCTTC
TGTAGTCAGACGGGCCCAGTGTCAGGTTCTGGTTCTGTTCTCTAAATATCTANAGGAGCTGTGTGACTTGGAGCCTCTGC
TCANGTCTTCTTGTGTGTCACAAANAAAACAGGAAGTANTATGTCATGGAGTTTTGTCCCTCTTTCCCTTCCTAGCCTAA
CACTTTGGATGTGATCAATCAGTTGANATGTACTGCTCTTTGGGGGCTANTGAGTATGCTCACCTCAGGCAGGCATGCTC
TANGGTCCTCGGCCTACACCTATCTATGCTGGCCCTANTTTTCCNTTCTGCATCATGTGGCACACTGCANTGTGCCTGCN
AGTGCTTGGTGGCCGGCTGGCGGCNGGCTCANNNTGTTTGGNGTGGTGGTAATTACTANGATGGCCCATCCCTAATGAGT
GTGATCTCGTTACACTCTTGCTGCTTCTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 55703842..55704349 470
 
EST/CDNA Est Name
  CA750290.1 - CJ128585.1 - CJ127306.1 - CJ129471.1 - CJ129634.1 - CJ127815.1 - CJ130506.1

 
Come back to gene CA750290.1 - CJ128585.1 - CJ127306.1 - CJ129471.1 - CJ129634.1 - CJ127815.1 - CJ130506.1


For any suggestions or comments, please send an email to unitrap@crg.es