Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11628G7
Clone ID IST11628G7
Vector VICTR76
Project tigm

Sequence tag IST11628G7HMR1
Sequence
TTTCCCACATTACTGATATTTCTGAATAGCTTTATTATTTTTAGTGGTGTAACCAATGGGCTTGTTTCCTTGTGTTGCTT
TTCACATGGGTTAAATTC
Sequence Type genomic DNA
Unitrap ID UNI31419

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 67675769..67675865 97
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024533 (Spire1) NM_176832 spire homolog 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1915416]

 
Come back to gene ENSMUSG00000024533


For any suggestions or comments, please send an email to unitrap@crg.es