Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13453H11
Clone ID IST13453H11
Vector VICTR74
Project tigm

Sequence tag IST13453H11HMF1
Sequence
CCTTGAACTCANAAATCCGCCTGCCTCTGCCTCCCAAGTGCTGGGATTAAAGGT
Sequence Type genomic DNA
Unitrap ID UNI16496 UNI31877 UNI33426 UNI34215

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_165754: 294875..294928 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 38416801..38416854 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 32531470..32531523 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 8495503..8495556 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 15013456..15013509 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 8134003..8134056 52
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039801 (2410089E03Rik) RIKEN cDNA 2410089E03 gene Gene [Source:MGI Symbol;Acc:MGI:1920942]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 41592600..41592653 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 26228454..26228507 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 4819099..4819152 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 5839889..5839942 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 12461703..12461756 52
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021745 (Ptprg) NM_008981 protein tyrosine phosphatase, receptor type, G Gene [Source:MGI (curated);Acc:Ptprg-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 33628497..33628550 52
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039552 (Rshl3) radial spokehead-like 3 Gene [Source:MGI (curated);Acc:Rshl3-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 11042639..11042692 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 30002304..30002357 52
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000058440 (Nrf1) NM_010938 nuclear respiratory factor 1 Gene [Source:MGI (curated);Acc:Nrf1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 16977208..16977261 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 30249620..30249673 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 4053978..4054031 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 10117459..10117512 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 12538970..12539023 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 16066715..16066768 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 13959079..13959132 52
NO GENE  


Sequence tag IST13453H11BBF1
Sequence
CCTTGAACTCANAAATCCGCCTGCCTCTGCCTCCCAAGTGCTGGGATTAAAGGTGTGCTT
Sequence Type genomic DNA
Unitrap ID UNI31810 UNI33992

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 28265184..28265242 57
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022523 (Fgf12) NM_183064 fibroblast growth factor 12 Gene [Source:MGI Symbol;Acc:MGI:109183]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 133964323..133964381 57
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000058966 (1500016O10Rik) RIKEN cDNA 1500016O10 gene Gene [Source:MGI Symbol;Acc:MGI:1916202]

 
Come back to gene ENSMUSG00000058966


For any suggestions or comments, please send an email to unitrap@crg.es