Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14268G5
Clone ID IST14268G5
Vector VICTR74
Project tigm

Sequence tag IST14268G5BBF1
Sequence
TTAACAATAAAGATCACGTGGATATCCCTGGTCTGGACTACCTCCTGGGACCATATTGATATCCAGGGGCTGTGCAGAGC
TGGCCTCACTCTTTGCTGGCTTCAACACTTAAGAAAGTGGGCCCTGTACTTCAACTTGGAAGCACAGTAGAGCTGGCTCT
GATGGTGTGGGTGAGGGGAATCCAGCCCCATGGGCATGAGAGCAGGAGAGCTGGTCTTGCCCCTTTCCAGATATGGCATT
AGGTGAGCCTGGGCAGTGCTGGAGAGTTTACCCTGGTGGTGTGGGTATGGGAGAGCTGATGTNANACTCTGGTGANCCNN
ANCTCNCCGGNNAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 30448833..30449162 316
 
EST/CDNA Est Name
  BB870337.1


Sequence tag IST14268G5HMR1
Sequence
GTTAATAGGAGACATGGACATCAACACAGATCCCTGCTGCTGCAT
Sequence Type genomic DNA
Unitrap ID UNI14329

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 30448793..30448837 45
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039697 (Ncoa7) NM_172495 nuclear receptor coactivator 7 Gene [Source:MGI Symbol;Acc:MGI:2444847]


Sequence tag IST14268G5HMF1
Sequence
TTAACAATAAAGATCACGTGGATATCCCTGGTCTGGACTACCTCCTGGGACCATATTGATATCCAGGGGCTGTGCAGAGC
TGGCCTCACTCTTTGCTGGCTTCAACACTTAAGAAAGTGGGCCCTGTACTTCAACTTGGAAGCACAGTAGAGCTGGCTCT
GATGGTGTGGGTGAGGGGAATCCAGCCCCATGGGCATGAGAGCAGGAGAGCTGGTCTTGCCCCTTTCCAGATATGGCATT
AGGTGAGCCTGGGCAGTGCTGGAGAGTTTACCCTGGTGGTGTGGGTATGGGAGAGCTGATGTNANACTCAGGTGANCCTN
NNCNCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 30448833..30449151 311
 
EST/CDNA Est Name
  BB870337.1

 
Come back to gene BB870337.1


For any suggestions or comments, please send an email to unitrap@crg.es