Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15109G1
Clone ID IST15109G1
Vector VICTR80
Project tigm

Sequence tag IST15109G1HMR1
Sequence
CATCATATGCTCATACCGGGAAGTGGTTAGAAACCCAAAGCACTGCCTTTCTGTTTCTGTTTCTAATGGCATCTTCAGAT
GAGAGATCCGAGCAACTTCTGGGCAGATGAGCTGAGACTCCAGCAGACACACCAGGCTTGCCACAATTCTGTCCTGTGTT
TCTCCTGGGTGAAAGAACTTGTTTATTGTCAAGGTCACCAGTTCCTGCAGATTAAGTTTCTAATGAGTTTTAGGACCATT
GTTCTATGTAGGAACATTATCTTCTCCGACCCTAAACTCCTGACTTAGTAATTAANCTCCTGTTCTCCAGATTGAGGGGT
GGGGAATCTGTGATTGGAAAATTGAGTTAAGTTATAAGCCTGAGGTTGTGTGGGCTTCCACCCAGCCCATATTCATAGAT
ATCANAATGTGGTTTGGTTTTGTGGCTNNNAAACAGGGTANGAGGGTACCAGTGACCCTNCNGTAGTAACTGGGCNCAGT
GANTCN
Sequence Type genomic DNA
Unitrap ID UNI34217

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 82880946..82881430 465
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038172 (Ttc39b) NM_027238 tetratricopeptide repeat domain 39B Gene [Source:MGI Symbol;Acc:MGI:1917113]


Sequence tag IST15109G1BBF1
Sequence
AAGACAAGGTTTCTCTTTATAGCCCTGGCTGTCCTGGATGTCACTTTGTATACCGGACTGCCCTCAAACTCAGAAATCTA
CCTGCCTCTGCCTCCCAAGTGCTGAGATTAAAGGCATGCACCACCACTGCCCTGCTCCTTTCAGTGTTTATTATGAACAA
ACACNGTCTCTTGACACATGCANCTGTTTTANATTGATNANANTCANAAAACATCNATGGCCCNNCTTTNNCNGNTGGCC
CTCATANCACATCTTTTTCCCACTCNNACCAANNCCANAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000038172


For any suggestions or comments, please send an email to unitrap@crg.es