Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12492E4
Clone ID IST12492E4
Vector VICTR76
Project tigm

Sequence tag IST12492E4HMF1
Sequence
GCGTGACCAGGGGAGCTGCCTCATTGCATGGTAGAAGTAGAGGAACCTGCAAGGCATTGGA
Sequence Type genomic DNA
Unitrap ID UNI11370

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 101211605..101211664 60
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042035 (Igsf3) NM_207205 immunoglobulin superfamily, member 3 Gene [Source:MGI Symbol;Acc:MGI:1926158]

 
Come back to gene ENSMUSG00000042035


For any suggestions or comments, please send an email to unitrap@crg.es