Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12680C9
Clone ID IST12680C9
Vector VICTR76
Project tigm

Sequence tag IST12680C9BBF1
Sequence
GTCTACAAAGTGAGTTCCAGGACAGCCAGGGCTACACAGAGAAACCCTGTCTCGA
Sequence Type genomic DNA
Unitrap ID UNI12851 UNI30898 UNI30900 UNI30901 UNI32309

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166310: 32064..32118 55
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_165754: 333376..333430 55
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000056050 (Mia3) NP_796363 melanoma inhibitory activity 3 Gene [Source:MGI Symbol;Acc:MGI:2443183]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr Y: 605476..605530 55
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000069045 (Ddx3y) NM_012008 DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, Y-linked Gene [Source:MGI Symbol;Acc:MGI:1349406]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 3426902..3426956 55
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 5661152..5661206 55
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 3761442..3761496 55
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 3731280..3731334 55
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 6355710..6355764 55
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 3414815..3414869 55
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 3349365..3349419 55
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 3105729..3105783 55
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 4373048..4373102 55
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 8960209..8960263 55
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033885 (Pxk) NM_178279 PX domain containing serine/threonine kinase Gene [Source:MGI Symbol;Acc:MGI:1289230]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 3480888..3480942 55
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000766 (Oprm1) NM_001039652 opioid receptor, mu 1 Gene [Source:MGI (curated);Acc:Oprm1-002]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 3681854..3681908 55
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 3660388..3660442 55
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023964 (Calcr) NM_001042725 calcitonin receptor Gene [Source:MGI Symbol;Acc:MGI:101950]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 3354407..3354461 55
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 3508104..3508158 55
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 3073808..3073862 55
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 3304366..3304420 55
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 4273311..4273365 55
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 3176223..3176277 55
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 4793036..4793090 55
NO GENE  


Sequence tag IST12680C9HMF2
Sequence
GTCTACAAAGTGAGTTCCAGGACAGCCAGGGCTACACAGAGAAACCCTGTCTCGA
Sequence Type genomic DNA
Unitrap ID UNI12851 UNI30898 UNI30900 UNI30901 UNI32309

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 4793036..4793090 55
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 3480888..3480942 55
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000766 (Oprm1) NM_001039652 opioid receptor, mu 1 Gene [Source:MGI (curated);Acc:Oprm1-002]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 3105729..3105783 55
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 3349365..3349419 55
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 3414815..3414869 55
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 8960209..8960263 55
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033885 (Pxk) NM_178279 PX domain containing serine/threonine kinase Gene [Source:MGI Symbol;Acc:MGI:1289230]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 6355710..6355764 55
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 3731280..3731334 55
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 3761442..3761496 55
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 5661152..5661206 55
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 3426902..3426956 55
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 3176223..3176277 55
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 3304366..3304420 55
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 3073808..3073862 55
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 3508104..3508158 55
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 3660388..3660442 55
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023964 (Calcr) NM_001042725 calcitonin receptor Gene [Source:MGI Symbol;Acc:MGI:101950]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 3354407..3354461 55
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 3681854..3681908 55
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 4373048..4373102 55
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_165754: 333376..333430 55
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000056050 (Mia3) NP_796363 melanoma inhibitory activity 3 Gene [Source:MGI Symbol;Acc:MGI:2443183]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166310: 32064..32118 55
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 4273311..4273365 55
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr Y: 605476..605530 55
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000069045 (Ddx3y) NM_012008 DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, Y-linked Gene [Source:MGI Symbol;Acc:MGI:1349406]

 
Come back to gene ENSMUSG00000069045


For any suggestions or comments, please send an email to unitrap@crg.es